Read Time:16 Minute, 47 Second

NKCE expression and purification

The sequences encoding each polypeptide chain of the NKCE molecules were inserted into the pTT-5 vector between the HindIII and BamHI restriction sites, as described previously29. The three vectors were used to cotransfect EXPI-293F cells (ThermoFisher Scientific, 100044202) in the presence of PEI (37 °C, 5% CO2, shaking at 150 rpm). Cells were seeded at a density of 106 cells per ml in EXPI293 medium (Gibco, A1435101) supplemented with valproic acid (0.5 mM), glucose (4 g l−1) and tryptone N1 (0.5%), and cultured for 6 days. NKCE molecules were purified with rProtein A Sepharose Fast Flow resin (GE Healthcare, 17-1279-03), followed by cation ion exchange chromatography onto two HiTrap SP-HP 1 ml columns (GE Healthcare, 17-1151-01) in series and finally dialyzed overnight against 1× PBS. The CD123-NKCE batch used for the NHP study was produced at Sanofi in a 200 l bioreactor with a CHO stable-producer clone, and purified according to the Sanofi process development platform procedure.

Recombinant protein cloning, production and purification

The human and cynomolgus recombinant proteins listed below were produced and purified at Innate Pharma as described previously29: human NKp46 (Gln22-Asn255, National Center for Biotechnology Information (NCBI) NM_004829.5), human neonatal Fc receptor (FcRn, NCBI P55899), human CD16a (human FcγRIIIA V and F isoforms, NCBI AAH36723), human CD32a (human FcγRIIA, NCBI AAH20823), human CD32b (human FcγRIIB, NCBI NP_003992), human CD16b (human FcγRIIIB, NCBI AAI28563), human CD64 (human FcγRI, NCBI P12314), cynomolgus NKp46 (Gln17-Asn254, NCBI NP_001271509.1), cynomolgus FcRn (NCBI Q8SPV9), cynomolgus CD16 (NCBI NP_001270121.1), cynomolgus CD32a (NCBI NP_001270598.1), cynomolgus CD32b (NCBI reference NP_001271060.1) and cynomolgus CD64 (NCBI AAL92095.1). The recombinant human CD123 was purchased from ACRO Biosystems (ILA-H52H6).

Surface plasmon resonance study of binding

A Biacore T200 instrument (Cytiva, 28975001) was used with Series S CM5 sensor chips (Cytiva, 29149603) and experiments were performed at 25 °C.

Affinity capture of the NKCE sample was achieved with the human antibody capture kit (Cytiva, BR1008-39). Seven serial 1:1 dilutions of either human and cynomolgus NKp46 or human CD123 in HBS-EP + buffer (Cytiva, BR1006-69) were prepared at concentrations of ranging from 1.56 to 100 nM. The CD123-NKCE (0.06 µg ml−1) was captured on the anti-Fc chip at a flow rate of 10 µl min−1 for 90 s to yield maximal response (Rmax) values of approximately 30 RU. Proteins were injected for 240 s at a flow rate of 30 µl min−1 onto captured NKCE, followed by a dissociation phase of 1,200 s. All analyte concentrations were run in duplicate, together with multiple buffer blanks for double referencing. The capture surface was regenerated with regeneration solution (3 mol l−1 MgCl2) at a flow rate of 30 µl min−1 for 60 s. The data were evaluated with Biacore T200 Evaluation Software v.3.0 (Cytiva) using a 1:1 binding model with a mass transport limitation.

For FcR binding studies, CD123-NKCE molecules and control human IgG1 antibodies were immobilized (at about 700 RU) onto the dextran layer of a CM5 Series S sensor chip on flow cells 2 and 3 by amine coupling chemistry. Flow cell 1 activated with NHS/EDC alone and deactivated with ethanolamine served as a reference flow cell for online blank subtraction.

For all experiments other than the FcRn binding study, HBS-EP+ 1× was used as the running buffer. For the FcRn binding study, acetate buffer pH 5.6 replaced HBS-EP+. Serial dilutions of FcRn and FcγRs were sequentially injected over a period of 2 min, at a constant flow rate of 40 µl min−1 over the CM5 chip and allowed to dissociate for 10 min before regeneration (10 s of 10 mM NaOH 500 mM NaCl and 10 s of HBS-EP+ at a constant flow rate of 40 µl min−1 for FcγRs and FcRn, respectively).

The sensorgram sets of human and cynomolgus FcγRI were fitted with the 1:1 binding model. The sensorgram sets of human FcγRIIa, FcγRIIb, FcγRIIIaF, FcγRIIIaV and FcγRIIIb, and cynomolgus FcγRIIa, FcγRIIb and FcγRIII were fitted with a steady-state affinity model.

The sensorgram sets of human and cynomolgus FcRn were fitted with a two-state reaction model. The experiment was performed three times, on three different days, with the same Biacore CM5 chip. The affinities for human and cyno FcRn and FcγRI were calculated from the kinetic association (ka) and dissociation (kd) rate constants: dissociation constant (KD) = ka/kd.

Affinities for human and cynomolgus FcγRII and FcγRIII receptors were calculated from Scatchard plot fits.

Biological samples

Healthy human buffy coats were provided by the Etablissement Français du Sang (EFS, the French blood service, Marseille; AC-2019-3428). Peripheral mononuclear cells (PBMC) were isolated from buffy coats by Ficoll density gradient centrifugation. Human NK cells were purified from PBMCs with a bead-based negative selection kit (Miltenyi, 130-092-657). Samples from patients with AML were provided by Institut Paoli-Calmettes (Marseille, SA-IPH-MImAbs Contract).

Cell lines

KG-1a, Kasumi-6, GDM-1, MOLM-13 and THP-1 AML cell lines were purchased at ATCC. M-07e, EOL-1, Kasumi-1, F36-P, NB-4, OCI-AML2, MV4-11, OCI-AML3 and SKM-1 AML cell lines were purchased at DSMZ. Cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% FBS, 2 mM l-glutamine, 1 mM sodium pyruvate and 1× nonessential amino acids (complete RPMI). Culture medium was supplemented with 25 mM HEPES for THP-1 cells. Quantification of CD123 expression on AML cell lines (antibody binding capacity) was performed by flow cytometry using mouse IgG calibrator kit (BioCytex, CP051). Anti-CD123 antibody 9F5 and isotype control (BD Biosciences, 555642 and 553447) were used at saturating concentration (10 µg ml−1) for the quantification. CD64 and CD32a/b expression in THP-1 cells was silenced with CRISPR–Cas9 endonucleases. For the generation of CD64-deficient THP-1 cells (THP-1 CD64-KO), 2.5 × 106 cells were nucleofected (Neon Transfection System, 100 µl tip, 1,700 V, 20 ms, one pulse) with two sgRNAs (CD64.1: CUUGAGGUGUCAUGCGUGGA; CD64.2: AAGCAUCGCUACACAUCAGC; Synthego) at a Cas9:sgRNA ratio of 1:9 (Alt-R S.p. Cas9 Nuclease 3NLS, Integrated DNA Technology). For the generation of CD32-deficient THP-1 cells (THP-1 CD32-KO), 2.5 × 106 cells were nucleofected with two sgRNAs (CD32A, AUGUAUGUCCCAGAAACCUG; CD32B, AAGCAUAUGACCCCAAGGCU; Integrated DNA Technologies) at a CAS9:sgRNA ratio of 1:9. Absence of CD64 and CD32 expression was confirmed by flow cytometry and cells were either sorted or subcloned.

NK cell-based cytotoxic assay

For cytotoxic assays performed on AML cell lines (that is, KG-1a, M-07e, EOL-1, Kasumi-1, F36-P, Kasumi-6, GDM-1, NB-4, OCI-AML2, MV4-11, OCI-AML3, SKM-1, MOLM-13, THP-1 or THP-1 CD64-KO, THP-1 CD32-KO), target cells were loaded with Cr-51.

Seven primary samples from patients with AML collected at diagnosis were used for the study. They were composed by PBMC and AML blasts. The day before the cytotoxic assay, primary samples were thawed, cells were counted with a trypan blue exclusion test and cultured in complete RPMI at 2 × 106 cells per ml. The viability of primary AML cells was monitored at each step of the experimental process. Primary cells AML samples were loaded with CalceinAM (8 µg ml−1; Life Technologies, C3100MP) for 30 min in the presence of 2.5 mM probenecid (ThermoFisher, P36400). Dilution ranges of both test and control items from 5 to 2.10−5 µg ml−1 (1/12 serial dilution) and 5 to 5.10−7 µg ml−1 (1/10 serial dilution) were performed for experiments with primary AML cells or AML cell lines, respectively.

Antibodies, target cells (roughly 3,000 cells) and human NK cells (roughly 30,000 cells) were successively added to each well of round-bottomed 96-well plates. After 4 h of coincubation, the supernatant was transferred to a Lumaplate (for Cr-51) or a flat-bottomed culture plate (for CalceinAM).

Cr-51 released from dead target cells was determined with a TopCount NXT (Microplate Scintillation and Luminescence Counter; Perkin Elmer). Radioactivity was measured by counting γ-emission for 60 s for each well. The results are expressed in cpm (counts per minute). CalceinAM released by dead target cells was determined by measuring the number of relative fluorescence units (RFU) with a luminometer (EnSpire Multimode Plate Reader, Perkin Elmer; excitation at λ = 495 nm and emission at λ = 516 nm). The percentage specific lysis was calculated with the following formula:

Specific lysis (%) = (ER (cpm or RFU) − SR (cpm or RFU))/(MR (cpm or RFU) − SR (cpm or RFU)) × 100 where ER = experimental release, SR = spontaneous release and MR = maximal release.

EC50 were determined by fitting the data with nonlinear regression curve model (log(agonist) versus response–variable slope (four parameters)) with GraphPad Prism Software v.8.0.2.

NK cell degranulation assay with AML samples

Tested items and PBMCs from patients with AML were added to each well of round-bottomed 96-well plates. After overnight coincubation with the NKCE molecules or antibodies, antihuman CD107a and CD107b antibodies (Miltenyi, 130-111-621 and 130-118-818) were added for 4 h. Cells were then washed and stained with the following mixture: viability markers, anti-CD45 (Miltenyi, 130-110-771), anti-CD33 (BD Biosciences, 564588), anti-CD56 (BD Biosciences, 557747) and anti-CD3 (BD Biosciences, 740187) antibodies. Cells were then washed, fixed and analyzed by flow cytometry. The data obtained were analyzed with Flowjo Software to assess NK cell degranulation by monitoring the expression of CD107a/b on NK cells identified as living CD45+CD33CD56+CD3 cells.

NK cell activation assay with AML cell lines

A dilution range from 15 to 15.10−7 µg ml−1 (1/10e serial dilution) was performed for both test and control items. The tested items, MOLM-13 cells (roughly 50,000 cells) and human NK cells (roughly 50,000 cells) from healthy donors were successively added to each well of round-bottomed 96-well plates. Control conditions were performed by adding only 50,000 resting NK cells by well. BD GolgiSTOP solution (BD Biosciences, 554724) was added at a final dilution of 1/6,000 in each well. A positive control of NK cell activation was performed by using Phorbol 12-myristate 13-acetate (PMA, 125 ng ml−1 final; SIGMA, P8139) and of Ionomycin (IONO, 1 µg ml−1 final; SIGMA, I0634) added on 50,000 NK cells. Each condition was performed in simplicate. After 4 h of coincubation at 37 ± 1 °C and 5 ± 1% CO2, an extracellular staining was performed for CD3, CD56, CD107a and CD107b (Human NK cell activation panel cocktail; Miltenyi, 130-095-212) and CD69 (Miltenyi, 130-113-523). An intracellular staining was performed for IFN-γ (Biolegend, 502536), TNF-α (BD Biosciences, 563996) and MIP-1β (BD Biosciences, 550078). Cells were analyzed by flow cytometry (Supplementary Fig. 3). Parameters were recorded with BD FACSDiva v.8.0 software and the analyses were done with FlowJo v10.5.2 software. Analysis of the percentage of NK cell activation was done with GraphPad prism v.8.0.2.

In vitro pharmacodynamic assessment and cytokine release in human PBMC

PBMCs from human healthy donors (n = 10) were seeded in 190 µl complete culture medium (500,000 cells per well) in 96-well U-bottomed plates (Costar, Ultra low binding CLS7007), and incubated at 37 °C and 5% CO2 for 20 h in presence of serial dilutions of CD123-NKCE, IC-NKCE control or CD123-TCE molecules. The basophil population, defined as TCRαβCD14IgE+ viable cells, was analyzed by flow cytometry and the absolute concentrations of cytokines released into the supernatant were analyzed by mesoscale discovery (MSD) assay.

For flow cytometry analysis, cell pellets were suspended in cold 50 µl staining buffer (Miltenyi, AutoMACS Running Buffer 130-091-221) supplemented with 1 µl of human FcR blocking reagent (Miltenyi, 130-059-901). A mixture of PBMC subset-specific antibodies and the viability reagent were added to the PBMC suspension according to the supplier’s instructions. As a fluorescence minus one control, additional points were obtained by labeling PBMC with the same mixture, but with each labeling antibody replaced in turn by its corresponding isotype control. Cells and antibody mixtures were incubated for 1 h at 4 °C in the dark, and then washed twice with 200 µl of staining buffer by centrifugation at 300g for 5 min at 4 °C. Cells were analyzed with a MACSQuant Analyzer from Miltenyi Biotec. Raw data were analyzed with VenturiOne v.6.1 software (Applied Cytometry Inc.). The gating strategy can be found in Supplementary Fig. 4.

For MSD assay, cell supernatant was diluted in MSD buffer following the manufacturer’s instructions. Diluted samples or prediluted multi-analyte calibrator samples were added to the precoated plate supplied in the kit. A solution of detection antibodies conjugated to electrochemiluminescent labels (MSD SULFO-TAG) was added and the plates were incubated at room temperature for 2 h before measurements. Data were analyzed with Excel 2019 software. The concentrations of IL-6, IL-1β, IFN-γ and TNF-α were determined from electrochemiluminescent signals by back-fitting to a calibration curve established with a four-parameter logistic model with 1/Y2 weighting.

Animal care

All animal procedures were approved by the Sanofi Animal Care and Use Committee, followed the French and European regulations on care and protection of the Laboratory Animals, and in accordance with the standards of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).

Antitumor activity against human MOLM-13 AML cells injected into severe combined immunodeficiency mice

The activity of the surrogate CD123-NKCE was evaluated in a disseminated human AML model consisting in MOLM-13 cells implanted in the tail vein of female severe combined immunodeficiency mice on day 0. Control groups were left untreated. Graph presented are the pooled results of four independent experiments (n = 20 mice per treatment group and 40 mice in the control group). Surrogate CD123-NKCE and anti-CD123 antibody were administered at doses of 5, 0.5 and 0.25 mg kg−1 by intraperitoneal injections on day 1.

Mice were checked and adverse clinical reactions noted. Individual mice were weighed daily until the end of the experiment (day 70). Mice were euthanized when they were considered moribund according to predefined criteria, to prevent animal suffering. The disease-related clinical signs considered critical were limb paralysis, ascites, palpable internal tumor masses, morbidity or a loss of at least 20% of total body weight loss.

For NK cell depletion, 100 µl of polyclonal anti-asialo-GM1 (Poly21460, Biolegend) antibody was injected intraperioneally into recipient mice at the indicated time points.

Pharmacodynamic activity in NHPs

A qualified flow cytometry panel composed of antibodies against the antigens CD45 (BD Biosciences ref. no. 563530, Clone D058-1283), CD14 (Miltenyi Biotec ref. no. 130-110-518, clone REA599), CD203c (Invitrogen ref. no. 17–2039, clone NP4D6), CD193 (Biolegend ref. no. 310708, clone 5E8), IgE (Miltenyi Biotec ref. no. 130-117-931, clone REA1049), CD123 (BD Biosciences ref. no. 554529, clone 7G3), CD33 (Miltenyi Biotec ref. no. 130-113-350, clone AC104.3E3) and the viability marker Zombie Nir (Biolegend ref. no. 423106) was used to evaluate the phenotype and counts of basophils and total CD123-positive immune cells in cynomolgus monkey blood and bone marrow samples. Blood (100 µl) and bone marrow samples (50 µl) were collected into a K3-EDTA anticoagulation air-vacuum tubes, incubated with a lysis solution (Biocytex CP025) for 10 min and centrifuged at 300g at room temperature for 5 min with Dulbecco’s PBS (Sigma D8537) before staining for 10 min, washing and fixation. We added 100 µl of flow count beads (Beckman ref. no. A91346) to the sample before acquisition on a Beckman Coulter Gallios (single dose pharmacokinetic/pharmacodynamics study) and BD FACS Verse (repeated dose toxicity study) instruments. The gating strategy for CD123-positive immune cells can be found in Supplementary Fig. 5.

Cytokine determinations on NHP plasma

In the single dose NHP pharmacokinetic/pharmacodynamics study, a qualified electrochemiluminescence assay method was developed using the MSD V-PLEX Proinflammatory Panel NHP kit (K15056D) for the quantification of IL-2, IFN-γ, IL-6 and IL-10 in monkey K3-EDTA plasma. In the repeated dose NHP toxicity study, an exploratory electrochemiluminescence assay method was developed using the MSD U-PLEX Proinflammatory Combo1 NHP kit (K150070K-2) for the quantification of IL-6, IL-2, IL-10, TNF-α, IFN-γ, IL-1β and IL-8 in monkey K3-EDTA plasma. Samples were analyzed according to the manufacturer’s recommendations. Analyses were performed in duplicate.

Pharmacokinetic/pharmacodynamic and toxicology studies in NHPs

CD123-NKCE solutions for administration (at concentrations of 0.1, 0.6, 20 and 600 µg ml−1) were prepared extemporaneously by diluting the stock solution in vehicle. They were kept at room temperature before and during administration. We used polypropylene, polycarbonate or PETG containers for dilutions, to prevent adsorption. These containers were coated with 100 ppm PS80 in 0.9% NaCl before use. The tubing used for each i.v. administration (syringe/winged needle) was coated, by successive flushes, with a solution of 100 ppm PS80 in 0.9% NaCl. The dosing volume was 5 ml kg−1 by 1 h i.v. infusion.

In the single dose pharmacokinetic/pharmacodynamics study, two males per group administered 3 or 3,000 µg kg−1 and one male administered 0.5 µg kg−1.

In the exploratory repeat-dose toxicity study, two animals per sex and per dose administered 0.1 or 3 mg kg−1 per administration, once weekly, for 4 weeks (on days 1, 8, 15 and 22). One monkey per sex per dose was euthanized and necropsied 1 week after the last administration and the remaining monkeys were euthanized and necropsied at 4 weeks after the last administration. The parameters evaluated included mortality, clinical signs, body weight, injection site examination, body temperature, electrocardiography parameters, hematology, clinical chemistry, coagulation and urinalysis, macroscopic observations, organ weights and histopathologic findings.

In both studies, serial blood samples were withdrawn from the brachial or saphenous or cephalic vein into K3-EDTA polypropylene tubes for plasma CD123-NKCE concentrations, 1.5, 5, 24, 48, 72, 168, 240, 336, 504 and 672 h after the start of the infusion, for the single dose pharmacokinetic/pharmacodynamics study and predose, 1, 1.5, 5, 24, 72 and 168 h after the start of each weekly infusion for the repeated dose toxicology study. Blood samples were placed on wet ice and centrifuged. The plasma samples obtained were frozen at −80 °C until analysis.

CD123-NKCE concentrations in plasma were determined by a dedicated immunoassay method in which CD123-NKCE were captured by biotin-coupled CD123 recombinant proteins and detected with a monkey-adsorbed Alexa Fluor-conjugated-goat antihuman IgG, with a lower limit of quantification at 0.250 ng ml−1.

Quantification and statistical analysis

Detailed information concerning the statistical methods used is provided in the figure legends. Statistical analyses were performed with GraphPad Prism software v.8.0.2, and v.8.3.0. Kaplan–Meier methods were used for survival analysis. When sample size was sufficiently large, the normality of populations was assessed with the d’Agostino-Pearson omnibus normality test. If the data were not normally distributed, the statistical significance of differences between paired sample populations was determined with the two-sided Wilcoxon matched-pair signed rank test. n is the number of samples used in the experiments. The means or medians are shown, with or without error bars indicating the s.d. Significance is indicated as follows: *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001, ****P ≤ 0.0001. Four-parameter nonlinear regression analysis was used to calculate the CD123-NKCE EC50.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.


Source link

Happy
Happy
0 %
Sad
Sad
0 %
Excited
Excited
0 %
Sleepy
Sleepy
0 %
Angry
Angry
0 %
Surprise
Surprise
0 %
Previous post A new single-player MechWarrior game is in the works, coming in 2024 – The Knowledge Pal
Next post CNET has been using AI, which it calls automation technology, to write financial explainer posts under a CNET Money Staff byline, apparently since November 2022 (Frank Landymore/Futurism) – The Knowledge Pal